EST details — SGN-E393989
Search information |
Request: 393989 | Match: SGN-E393989 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C172829 | Clone name: TUS-14-I19 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C172829 is on microarray TOM1 spot ID 1-1-6.1.20.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C11011 [cLEC-6-O18] | Trace: SGN-T23981 | EST: SGN-E202320 | Direction: 5' | Facility: TIGR |
Clone: SGN-C172829 [TUS-14-I19] | Trace: SGN-T195128 | EST: SGN-E393802 | Direction: 3' | Facility: INRA |
Clone: SGN-C172829 [TUS-14-I19] | Trace: SGN-T195314 | EST: SGN-E393988 | Direction: 3' | Facility: INRA |
Clone: SGN-C172829 [TUS-14-I19] | Trace: SGN-T195314 | EST: SGN-E398951 | Direction: 3' | Facility: INRA |
Clone: SGN-C172829 [TUS-14-I19] | Trace: SGN-T200442 | EST: SGN-E399524 | Direction: 5' | Facility: INRA |
Sequence |
Sequence Id: SGN-E393989 | Length: 204 bp (917 bp untrimmed) |
Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E393989 [] (trimmed)
ACCTTTTTTAGCAATGCTCTGTTTCTCTCAATTTCCTATCCCTCTCTTCTTTTTCCTCTCTATCCTCCTTATCCTCCCACACCATTGCCTCGCAA
ACTGCCACGTGGACGATGAGACCGGGTTGTTAGGATTCAAATCGTGTATCAAATCTGACCCGTCAAGTCATCAGGCATACACCAAATCGCGGACC
GATAATTAAAAATC
ACTGCCACGTGGACGATGAGACCGGGTTGTTAGGATTCAAATCGTGTATCAAATCTGACCCGTCAAGTCATCAGGCATACACCAAATCGCGGACC
GATAATTAAAAATC
Unigenes |
Current Unigene builds | |||||
[SGN-E393989] | SGN-U575404 | Tomato 200607 | Build 2 | 43 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T195315 [Download][View] | Facility Assigned ID: FA0AAD2AE10RM2 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.953 | Expected Error Rate: 0.0212 | Quality Trim Threshold: 14.5 |