EST details — SGN-E393992

Search information 
Request: 393992Match: SGN-E393992
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172875Clone name: TUS-14-K17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172875 is on microarray TOM1 spot ID 1-1-8.3.20.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14192 [cLEC-7-C22] Trace: SGN-T25246 EST: SGN-E201964 Direction: 5' Facility: TIGR
Clone: SGN-C172875 [TUS-14-K17] Trace: SGN-T195595 EST: SGN-E394269 Direction: 3' Facility: INRA
Clone: SGN-C172875 [TUS-14-K17] Trace: SGN-T195595 EST: SGN-E398968 Direction: 3' Facility: INRA
Clone: SGN-C172875 [TUS-14-K17] Trace: SGN-T199438 EST: SGN-E398112 Direction: 3' Facility: INRA
Clone: SGN-C172875 [TUS-14-K17] Trace: SGN-T199587 EST: SGN-E398261 Direction: 5' Facility: INRA
Clone: SGN-C172875 [TUS-14-K17] Trace: SGN-T199587 EST: SGN-E398969 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393992Length: 564 bp (839 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E393992 [] (trimmed) TTCAAAATCAATCCAAACAGAGCCTTAACAGGGCCCAAGATAGCTTCTAGTCAAAATCTTACACACAATAAACTCACCACCACAGCGGCAGCAGT
AGCAGACCGGAATCTCCTCCTTCCTCCTCCGTCTGCTCCGCCGTCTTTCTCCGATCAGCCGCCGTCCTCCTCCTTCGCTCCAAAACCGTACTGTT
AACACCGTGGTTTGGCTGTTTGTGTATCAAAATCTCAACTACCAAACAGTCAACAACTACTTATCTACTTATATACAACTACTTTTTCGTGTTTG
TATCAGAGAGGTATAGGAAATGGAGTCGAGTTTGGAGTTGTTGAGATCGATTGAATCGGCATTGGGAGTGTCGTTGGGGAGTGATACGGTGTTGG
TGCTACTTACGACGTCGTTCGCGGTCGTCGTTGGATTAGTAGTGTGCGGGGGGGGGAGATCAAGTGATCGAAGTAAAGAAGTGAAGCCTGTGGTG
TTCCCCAAGTCCTTACTTGGGGAGCCGGAGGAGGAGACTGAGCTAAAACCCTGGAAAAGTTAAAGTCACCGTATTTTTCGGTACCCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393992] SGN-U581827 Tomato 200607 Build 2 94 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195318 [Download][View] Facility Assigned ID: FA0AAD2AF09RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.989 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5