EST details — SGN-E394065

Search information 
Request: 394065Match: SGN-E394065
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172828Clone name: TUS-14-I18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172828 is on microarray TOM1 spot ID 1-1-7.1.20.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C11010 [cLEC-6-O16] Trace: SGN-T23980 EST: SGN-E202319 Direction: 5' Facility: TIGR
Clone: SGN-C172828 [TUS-14-I18] Trace: SGN-T195241 EST: SGN-E393915 Direction: 3' Facility: INRA
Clone: SGN-C172828 [TUS-14-I18] Trace: SGN-T195391 EST: SGN-E399069 Direction: 3' Facility: INRA
Clone: SGN-C172828 [TUS-14-I18] Trace: SGN-T199601 EST: SGN-E398275 Direction: 5' Facility: INRA
Clone: SGN-C172828 [TUS-14-I18] Trace: SGN-T200215 EST: SGN-E399070 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394065Length: 490 bp (852 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E394065 [] (trimmed) AAAATCTCCTTTTTGCTATCTCTTTTCTCTATATATGGCTTTTGAATTCATGAAAATCACGTTCTCAAGCTCACGTCAACTTCGAAAATTCTTTA
TATCACTATAATCCACAACCAAAGACTTTTAAGCCTCATATAATCACAACCACAACCTATCTTGTATGAGATAAATTTCAAGTGCTATAAATATA
CCTAACGAAAAGTTATAGTTAGCAGTACTGAAAAAAACGAGATAAACATGAGTAATTGTTTGCAAAGCTGGCCGGAGCCAATTGTCCGAGTTCAA
GGACTCTCGGAAAGTGGCATTCGAGAAATCCCTGACCGGTACGTGAAACGACCATCGGATCGTCCATGTTTCAAGGAGACAACAACGTTGTCGTC
ATCATCACACCTTGAGAATATTCCGTTAATTGACCTTGAGGACGTGAATTCATCGGATGAATCCATTCCCGATGAGACAATGGAACTCATTTCCA
AGGCTTGTCGCGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394065] SGN-U564996 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195391 [Download][View] Facility Assigned ID: FA0AAD2BE09FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0041 Quality Trim Threshold: 14.5