EST details — SGN-E394159

Search information 
Request: 394159Match: SGN-E394159
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183523Clone name: TUS-42-G9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183523 is on microarray TOM1 spot ID 1-1-8.3.1.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C87600 [cLET-5-E13] Trace: SGN-T103614 EST: SGN-E290166 Direction: 5' Facility: TIGR
Clone: SGN-C183523 [TUS-42-G9] Trace: SGN-T195950 EST: SGN-E399151 Direction: 3' Facility: INRA
Clone: SGN-C183523 [TUS-42-G9] Trace: SGN-T200449 EST: SGN-E399557 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394159Length: 154 bp (905 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E394159 [] (trimmed) GATAAATATCGTCATATATATATATATATATAATACATGATGTAGTTTTTACCCAAGTTACCACATATTGAAGTAGTAGTATGTACAAAATTAGG
AAATTGCTCTGTTTTCATATATTGTTATTAGTCTCAGACATTCACACCAATATGTTTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394159] SGN-U565599 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195485 [Download][View] Facility Assigned ID: FA0AAD30AD05FM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.846 Expected Error Rate: 0.0128 Quality Trim Threshold: 14.5