EST details — SGN-E394176

Search information 
Request: 394176Match: SGN-E394176
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183681Clone name: TUS-42-M23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183681 is on microarray TOM1 spot ID 1-1-2.1.1.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C80683 [cLET-13-B24] Trace: SGN-T106001 EST: SGN-E294158 Direction: 5' Facility: TIGR
Clone: SGN-C183681 [TUS-42-M23] Trace: SGN-T195970 EST: SGN-E394644 Direction: 3' Facility: INRA
Clone: SGN-C183681 [TUS-42-M23] Trace: SGN-T195971 EST: SGN-E394645 Direction: 5' Facility: INRA
Clone: SGN-C183681 [TUS-42-M23] Trace: SGN-T199410 EST: SGN-E398084 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394176Length: 581 bp (831 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E394176 [] (trimmed) GTATAAATTCGATAGTTACATTTTCAAGATACTCCAGTACTCACTTTACGAGCATTGAATTAGGTTAGTTACAAGACAAACTGTGCCATTTGGAG
TGTACAGAACAGTGAAGAAATCTCAAATTCACTAGTCATGATTTAATGTTCTTTGTCACACCAATGTCCTTTTGTCATTTACAGACTTCTTTGAT
AGCGTTGAGCATTCACAGACATCCCACCATCATCTCCACGGAACTGTCTATACCTGAAGAGATCATCGCTACCTTTGTTCAATCTGCCTCTGGGA
GGCATAGGTAGCAGAGGTAATGCATTTGGATGGTGACAGATTCCGAGTTTCACTACAAACGTGACAGTGGTTCCCTTTCCAGGGCCCTCACTCTC
AATCCAAATGTTACCTTTCATAAGTTGAATAAATCGTCTGCAAATGGCAAGCCCTAAACCTTCCCCTCCAGTACTTCGATTTGACGTAGGCCGTG
ACTCTGCAAATTTGGTGAATACTAGTGGTATATCTTGTGGGCTAATTCCCCACCCAGTATCTCTAACCTGGAACCGCAAATAAAACTGGCCCTCA
CTTGGCATAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394176] SGN-U580538 Tomato 200607 Build 2 122 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195502 [Download][View] Facility Assigned ID: FA0AAD30AG12FM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0062 Quality Trim Threshold: 14.5