EST details — SGN-E394277
Search information |
Request: 394277 | Match: SGN-E394277 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C172925 | Clone name: TUS-14-M19 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C172925 is on microarray TOM1 spot ID 1-1-6.1.20.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C14296 [cLEC-7-H19] | Trace: SGN-T25459 | EST: SGN-E202177 | Direction: 5' | Facility: TIGR |
Clone: SGN-C172925 [TUS-14-M19] | Trace: SGN-T195149 | EST: SGN-E393823 | Direction: 3' | Facility: INRA |
Clone: SGN-C172925 [TUS-14-M19] | Trace: SGN-T195324 | EST: SGN-E393998 | Direction: 5' | Facility: INRA |
Clone: SGN-C172925 [TUS-14-M19] | Trace: SGN-T195602 | EST: SGN-E394276 | Direction: 3' | Facility: INRA |
Clone: SGN-C172925 [TUS-14-M19] | Trace: SGN-T195602 | EST: SGN-E398983 | Direction: 3' | Facility: INRA |
Clone: SGN-C172925 [TUS-14-M19] | Trace: SGN-T195603 | EST: SGN-E398984 | Direction: 5' | Facility: INRA |
Sequence |
Sequence Id: SGN-E394277 | Length: 252 bp (846 bp untrimmed) |
Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E394277 [] (trimmed)
ACAATCGAAAAGGAATTCTTCTTTGATGCTGAGATACTATTCAGTGCATAATGCAATAAATCATGCCTGTGTATACTATCTATCTATAGTACAAT
GTTTACACATTTCTCCCTATTAACATACCCAGCTAAATTAGCTTTTACAAAGTTTTTCTTATTATTGCATTTCCTACTTCTCACTTCTTCTCCAG
TAGCTGAAGTGAACATGATGTGATGGTTTTGGATCATGTGTAATCAATAATACAAGCACCTA
GTTTACACATTTCTCCCTATTAACATACCCAGCTAAATTAGCTTTTACAAAGTTTTTCTTATTATTGCATTTCCTACTTCTCACTTCTTCTCCAG
TAGCTGAAGTGAACATGATGTGATGGTTTTGGATCATGTGTAATCAATAATACAAGCACCTA
Unigenes |
Current Unigene builds | |||||
[SGN-E394277] | SGN-U564724 | Tomato 200607 | Build 2 | 54 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T195603 [Download][View] | Facility Assigned ID: FA0AAD2AG10RM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.918 | Expected Error Rate: 0.0020 | Quality Trim Threshold: 14.5 |