EST details — SGN-E394303

Search information 
Request: 394303Match: SGN-E394303
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183203Clone name: TUS-41-J1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183203 is on microarray TOM1 spot ID 1-1-8.2.3.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C5862 [cLEC-33-G12] Trace: SGN-T30120 EST: SGN-E206848 Direction: 5' Facility: TIGR
Clone: SGN-C183203 [TUS-41-J1] Trace: SGN-T195182 EST: SGN-E393856 Direction: 3' Facility: INRA
Clone: SGN-C183203 [TUS-41-J1] Trace: SGN-T195629 EST: SGN-E398866 Direction: 5' Facility: INRA
Clone: SGN-C183203 [TUS-41-J1] Trace: SGN-T199546 EST: SGN-E398220 Direction: 5' Facility: INRA
Clone: SGN-C183203 [TUS-41-J1] Trace: SGN-T199592 EST: SGN-E398266 Direction: 3' Facility: INRA
Clone: SGN-C183203 [TUS-41-J1] Trace: SGN-T199592 EST: SGN-E398865 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394303Length: 617 bp (826 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394303 [] (trimmed) ACAAATCCATATTATCAAACTTCATACACATAAGGCACATACATATGCACTTACATACAGAAATATCAAATACAGTACTAACAATTATCCTTCAG
AATCCAAAAAAAACAAAAGTGAAGGAAATGAAAAACACTTAAAAACCAAAACAACACAGAAACACAATCATAACATCCCAAAAGTAAAATTAAAA
AAACATTTCATTTCATTTAGTCTTTTTCCTTCTCCTTTTCCTCTTCAGCCTTTGAGTGGTATCCTGGTAATTTCTCCTTAATTTTGTCCAAAAAT
CCCTTCTTCTCCTTCCCCTCCGCCTCATGCTCCACCGCAGCCGGTGGTGGTGGTGGTGGCGCCGCCACTTCCTCCGTCTTCTTATGCCCGCCACC
TGGCAATTTCTCCTTAATTTTGTCTAGAAATCCTTTTTTCTCCTCTGTTTCCTCGTATTTCTCAACTGGAACTGAGGTATCCTCTGCTTTCGATT
CTTCCTTGTGATCACCAGATATTTTTTTCTTAATCTTATCCTTCAATCCCTTCTTTTTCTTCTTCTTGATCTTCTGTCCATCCTCTCCAATTTCT
TCCTCCTCATCACTGGAGCTACTAGAGCTGCTATTTGACCTGCAGCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394303] SGN-U581375 Tomato 200607 Build 2 231 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195629 [Download][View] Facility Assigned ID: FA0AAD29CE01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0051 Quality Trim Threshold: 12.5