EST details — SGN-E394344

Search information 
Request: 394344Match: SGN-E394344
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172738Clone name: TUS-14-E24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172738 is on microarray TOM1 spot ID 1-1-1.1.20.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10877 [cLEC-6-I19] Trace: SGN-T24089 EST: SGN-E202428 Direction: 5' Facility: TIGR
Clone: SGN-C172738 [TUS-14-E24] Trace: SGN-T195228 EST: SGN-E393902 Direction: 3' Facility: INRA
Clone: SGN-C172738 [TUS-14-E24] Trace: SGN-T195669 EST: SGN-E394343 Direction: 3' Facility: INRA
Clone: SGN-C172738 [TUS-14-E24] Trace: SGN-T195669 EST: SGN-E399049 Direction: 3' Facility: INRA
Clone: SGN-C172738 [TUS-14-E24] Trace: SGN-T200210 EST: SGN-E399050 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394344Length: 638 bp (793 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394344 [] (trimmed) CACTAATGGGGTCTGGGGAGGGTAGAGTGTAGGCAGACCTTACCACTACCTCGTGGAGGTAGAGAGGCTGTATTACAATCTCAAATTCCTCGCTG
GTAAGAAACTATGGATGCACTGCTTGCAAGCATTTTGAAGTTTGTCTTAGTAAGCTAAAGCCATGACCTTTTATCTTAGATTTAATTAAAGTATT
GAGACACAGTAACTTCTCTACATGTTTGAATTTCTTTTGGTTAGGTTCTACATCAAACGTATATAAGTTTATTTTGTATCGCCTCTTTATGGACT
TCAAATACTGAGCTTTAATTGCTCCTATGACATTAAAAATATTTAATGCGTAAATTGTTGGAATAATATTGTTGCATTTGGCTTTAGTGTCTGGT
TGTGGAAATTCTTCTCCATGGAAGCAAACCGAGGGAGTTAGCTATGTGCAAAGAATTAACTGGTAAAAAATAGTTAAACCATTATCTTTTCTATC
TCTCAACCTATACTTGCAGAGCATAGGTGATCTCAAGTTCCAGATAATGGAAGATCGTTGACAGGCAGCGTAAATAGTCAAATTCCAACAATTCA
TATAACCGACTCAATTTTGTTCAAAAAAAATAAATTGATGGATCGCTTCTATATAGCTGCTGTAAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394344] SGN-U577743 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195670 [Download][View] Facility Assigned ID: FA0AAD2BC12RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0049 Quality Trim Threshold: 14.5