Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E394394

Search information 
Request: 394394Match: SGN-E394394
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182634Clone name: TUS-40-B8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182634 is on microarray TOM1 spot ID 1-1-1.2.6.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182634 [TUS-40-B8] Trace: SGN-T195721 EST: SGN-E394395 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394394Length: 622 bp (870 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E394394 [] (trimmed) GATTCTTTGGAAGCTACAAATTTGGCTCGGTCTTTTACCTTCTCCTGTTGTGCTCGACTTCCAGATCTCTTGGCAGCTTTTAACTGCTTATCATA
AATCTCAAATTTCTTGTTCATCTCTTTGCGACGCTGTTCATATCCACTTTCAAAATCATCAAAGTTACCACGATAGAAGTGTAGTTTCATGTCAT
GGAGATGAATAATCTCACCGCAAACAGTGTTCAGAAAGTCTCGATCATGTGAAACAACGACCAAAGTTTTCTTCCATCTGCACAAGTACTCCTCT
AACCATAGAACAGCCCGAAGGTCAAGATGATTTGTAGGTTCATCCAACAACAATAGAGTAGGCTGAACAAAAAGAGCCCGTGCTAGAGAAATTCT
CATCCTCCAACCACCACTAAAAGATCGGGTAGCACGCCCCTGCATTTCCTTGGTGAAACCCAGCCCAGCAAGAATTTTTGATGCTTGGGCCTCAG
CAGCATCTGATCCCATCAGCTGCAACCTTTCGTACAGTTCAGAAAGTTTTTCTACAATGTTGTCCCCATCAGCATCATCTTCATTCTCACCAACA
GTTGCAGCAGCATTCTGTAAAGATGCAGCCTCTTCTCGGAGCTTGATTAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394394] SGN-U568949 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195720 [Download][View] Facility Assigned ID: FA0AAD28DA04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0030 Quality Trim Threshold: 14.5