EST details — SGN-E394552

Search information 
Request: 394552Match: SGN-E394552
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172791Clone name: TUS-14-H5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172791 is on microarray TOM1 spot ID 1-1-4.4.20.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10953 [cLEC-6-L3] Trace: SGN-T24183 EST: SGN-E202522 Direction: 5' Facility: TIGR
Clone: SGN-C172791 [TUS-14-H5] Trace: SGN-T199632 EST: SGN-E398306 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394552Length: 581 bp (852 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E394552 [] (trimmed) ATCTACTACAATAAACCGTGCATATTCGAAAAACCAAGTGTACGTATTGGATCATAGGAACCTACCATAAGTAGGTACTAACAAAAGATCGTAAA
GGACTCTCTTTCTTATGAGTCTTCTCAAAACATTAGTTTATACATACAATTTTGAGAACACATACATTCTCAGTTCCTTCTTCCTTGCCTGTTCC
GATCTGTCTGAATATATACATGAGCTCTTCACGCAAAAAGAAAACCTCTTCCTCCTAACTTTTATCCCTTTTGACTATTCATTCATCAGTGGAAA
GTGTAAAAAGTTGAGCAGAAAAAATGAAAATCCTCATTCTTCTTCTTCTTCAACACAAGCTGAGTTTACTACACTAAATTTGGTCCACTATACAG
TGCTCCAGCTACAGTCAAGTCCTCAGGTTTCTCCCTCTCTTTGAGCCATGCATACTCACTTTGCTCTTCTTCAGGTACTAAAAAGTCATTCACTG
ACATGTTGGCAAAGGGGAAGTCATAGTAGTATTGGCAGTGGCGACCGTCAGGATCACAATAAGGTGGGCCGACAACATCTAGTAGGGTGCAAGCT
GTCCTTTGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394552] SGN-U571474 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195878 [Download][View] Facility Assigned ID: FA0AAD2CD03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0037 Quality Trim Threshold: 14.5