EST details — SGN-E394741
Search information |
Request: 394741 | Match: SGN-E394741 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C183413 | Clone name: TUS-42-B19 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C183413 is on microarray TOM1 spot ID 1-1-6.2.1.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C32398 [cLEG-1-E7] | Trace: SGN-T64425 | EST: SGN-E248362 | Direction: 5' | Facility: TIGR |
Clone: SGN-C183413 [TUS-42-B19] | Trace: SGN-T195072 | EST: SGN-E393746 | Direction: 3' | Facility: INRA |
Clone: SGN-C183413 [TUS-42-B19] | Trace: SGN-T195072 | EST: SGN-E399341 | Direction: 3' | Facility: INRA |
Clone: SGN-C183413 [TUS-42-B19] | Trace: SGN-T200339 | EST: SGN-E399342 | Direction: 5' | Facility: INRA |
Sequence |
Sequence Id: SGN-E394741 | Length: 173 bp (915 bp untrimmed) |
Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E394741 [] (trimmed)
CTTAGGCATGCAAGACTTTTGATCAAGCTAAGGAGGAATATAGCAAGGAGTTTGAAGAGAAGAAGACTGAGCTTCCACCCAAAGTTGTTGAAATT
TATGAAGCTGCTGCAGTTGAGATCAAGAGCTTATTGAAGGAACCAAAGGGTGCGGGGCAGAATAACAAACCAGATGGG
TATGAAGCTGCTGCAGTTGAGATCAAGAGCTTATTGAAGGAACCAAAGGGTGCGGGGCAGAATAACAAACCAGATGGG
Unigenes |
Current Unigene builds | |||||
[SGN-E394741] | SGN-U580472 | Tomato 200607 | Build 2 | 105 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T196067 [Download][View] | Facility Assigned ID: FA0AAD30CA10RM2 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.930 | Expected Error Rate: 0.0125 | Quality Trim Threshold: 14.5 |