Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E394901

Search information 
Request: 394901Match: SGN-E394901
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183871Clone name: TUS-43-E21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183871 is on microarray TOM1 spot ID 1-1-4.1.18.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10778 [cLEC-6-E10] Trace: SGN-T23953 EST: SGN-E202292 Direction: 5' Facility: TIGR
Clone: SGN-C183871 [TUS-43-E21] Trace: SGN-T1785 EST: SGN-E378622 Direction: 5' Facility: Giov. Lab
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394901Length: 368 bp (877 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E394901 [] (trimmed) GTGGCATTATTGCCTAAACTATTGGAATCGTTCTCTTTAGTTCCCAACTAGCAGAAATCCTTCCTAAGCTAGACCATTTGGAACACTGTGCTATG
AAGAGACGTTCACCAAGCTTTATGGTTTACAAATGTATATATTAACTTGTGCTTTTCATCCATAGAGCTTGAGATTTGACACTATAGGCAAAAAG
TTCGGATTGTTTGTTCCTAGACTGCATACATCCTCTTGTAGCTTTCACCATAGAGCTCTGTATCTGATGCCACAGATATAGCATATGAATGTGAA
TGAGTTCCCTGGCCCCTCTTATACTCCTCATCTTCGACTCTTCTACCCTATGTCAAACTACACATTAGCACATGGAACCAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394901] SGN-U594202 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196227 [Download][View] Facility Assigned ID: FA0AAD31AC11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0453 Quality Trim Threshold: 14.5