EST details — SGN-E394908

Search information 
Request: 394908Match: SGN-E394908
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183903Clone name: TUS-43-G5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183903 is on microarray TOM1 spot ID 1-1-4.3.19.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10907 [cLEC-6-J4] Trace: SGN-T24043 EST: SGN-E202382 Direction: 5' Facility: TIGR
Clone: SGN-C183903 [TUS-43-G5] Trace: SGN-T196233 EST: SGN-E394907 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394908Length: 379 bp (883 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394908 [] (trimmed) GAGAATGTCTCTGTCTGTACTATGATAAGCTCTACGAGTTGCATTCACAGTATCCGTCCAAACGTCATGCTCTTTCAAAATATTGTTAAACAAAT
GTGTCTGCAAGTAGTTTGCTACATCATGGCCCATATGTCCATCATAGATTGCGAATAGTCCCAAATCGTTGTTATGGACTTGCTTAAACTCACAA
ACTAAACAATCTTCCATCGCGTGATTAGACTTTCCCTTCACCAGGTGGGAACCATGAGTGATCCGCTTTGATGCTCCGCCCTTGCCTCTTGTATC
TGGTGAGTCTGGCATGGAAGCCATAAAACATGCCTTTTCCTTCATCTTGTGCAGGATTTCTCTTCCTCCAGTCATGATTTTGAAATAGTTTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394908] SGN-U567601 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196234 [Download][View] Facility Assigned ID: FA0AAD31AD03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0005 Quality Trim Threshold: 12.5