EST details — SGN-E395223

Search information 
Request: 395223Match: SGN-E395223
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184640Clone name: TUS-45-E22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184640 is on microarray TOM1 spot ID 1-1-3.1.14.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C83292 [cLET-24-A24] Trace: SGN-T108612 EST: SGN-E296095 Direction: 5' Facility: TIGR
Clone: SGN-C184640 [TUS-45-E22] Trace: SGN-T198616 EST: SGN-E397290 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395223Length: 574 bp (821 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E395223 [] (trimmed) GTAAGTTTGAGAAACGTCTAGTCTAGAGAGAAATGGCAAATCCAAAGGTTTTCTTTGACCTTACCATCGGTGGTGCACCAGCTGGTCGTGTGGTG
ATGGAGCTCTTCGCCGATACCACTCCCAAAACCGCTGAGAACTTCCGAGCTCTTTGTACCGGTGAGAAAGGTGTTGGAAAGATGGGGAAGCCTTT
GCACTACAAGGGCTCAACCTTCCACCGTGTGATCCCAGGGTTCATGTGTCAAGGAGGTGATTTCACCGCCGGAAACGGGACCGGAGGAGAGTCGA
TCTATGGAGCCAAATTCAACGATGAGAACTTCGTTAAGAAGCACACCGGCCCTGGAATCCTCTCCATGGCTAATGCTGGACCTGGAACCAACGGT
TCTCAGTTTTTCATCTGTACCGCTAAGACTGAGTGGCTCAACGGAAAGCACGTCGTGTTTGGACAAGTTGTTGAAGGCATGGATGTGATTAAGAA
GGCAGAGGCTGTTGGATCTAGCTCTGGAAAGTGCTCCAAACCTGTGGTTATTGCTGACTGCAGTCAACCTCTAAATCTGATGATAATAATGATCT
AGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395223] SGN-U577630 Tomato 200607 Build 2 444 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196549 [Download][View] Facility Assigned ID: FA0AAD33BC11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5