Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E395296

Search information 
Request: 395296Match: SGN-E395296
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172989Clone name: TUS-14-P11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172989 is on microarray TOM1 spot ID 1-1-6.4.20.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14432 [cLEC-7-O19] Trace: SGN-T25234 EST: SGN-E201952 Direction: 5' Facility: TIGR
Clone: SGN-C172989 [TUS-14-P11] Trace: SGN-T196623 EST: SGN-E395297 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395296Length: 355 bp (834 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E395296 [] (trimmed) GGGCGAGATATCAAGTCTTAATTAAAACAAAATGCCAAAAGCAGAGTCATTGAGAATATGTAAACCCAGAGTATAAAATATTACATGAATTCAAC
TAAAGTTACTGTAAAGCAACATTCTTTTAAAGAAAGGAAAATGTACTGAAAAAAAAATAATACTGATAAGTGGATCCATCTCTGGATCTCCGGAA
TCACCACGATCTAACGGGAGGATAACGGTGACGGTAGCATCAGCGCCTCCTCAGAACACCTTGACGTTGGCTCTACCGATACAGCAATCGAGACC
TGCTGGAGCGTCTGGCGGCGGTGGAGGTAGTGGTGGTGGAAGGGAGGATTGTTGGATTTATAATGATACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395296] SGN-U580140 Tomato 200607 Build 2 69 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196622 [Download][View] Facility Assigned ID: FA0AAD2CH06FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0037 Quality Trim Threshold: 14.5