Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E395424

Search information 
Request: 395424Match: SGN-E395424
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C173588Clone name: TUS-16-I10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C173588 is on microarray TOM1 spot ID 1-1-7.1.18.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C3521 [cLEC-20-N3] Trace: SGN-T27817 EST: SGN-E206035 Direction: 5' Facility: TIGR
Clone: SGN-C173588 [TUS-16-I10] Trace: SGN-T196751 EST: SGN-E395425 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395424Length: 549 bp (910 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E395424 [] (trimmed) AAAAAATAATGCCTAAATCTGGCAAACTTTTAATACATATTTGTATTTACAACAAAAAAATTGTGAAAAATACATGAAAGGCTTGAGCCACTTAA
GTAAAATCTACCTGTGTCAATAAAGTATGAAGCAGCTTCTCTTTGAAAAAGTGCTCGTATAAAGTTTAATCTCTGTAAACCCACCCCCATGGTGC
AATCTCCTATCCTTTTTTTAAACGGTACATATAATCATCTCCTATCGTAAAACCATAATTAAAAAAAACTAGGCATCTTTACTATCAGGAAAGTC
AGTATCAAGCACACCGATAACGGAAGATAGGGCTGAATTCCACTCTTGCACGCCACTCTGAGGATCCTTTTTCCTCATAAATTCCAGCTTATTAA
TAACCTCCTTTGGAACACCGCATTTAAAAAAAACAATTCCGAGTGATTTGAATGTTGAATCATCAGGTTGGATGGCAAAAAAAAGCATTTCCTTG
TAAGTAGCCAAAGCTTCTTTATACCTCCCATCAGTTGCACACAATCCAAGCACATTGTTGTAACTCAACAAGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395424] SGN-U603765 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196750 [Download][View] Facility Assigned ID: FA0AAD4BE05FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0121 Quality Trim Threshold: 14.5