Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E395529

Search information 
Request: 395529Match: SGN-E395529
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183826Clone name: TUS-43-C24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183826 is on microarray TOM1 spot ID 1-1-1.3.18.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C1949 [cLEC-14-G12] Trace: SGN-T26428 EST: SGN-E204812 Direction: 5' Facility: TIGR
Clone: SGN-C183826 [TUS-43-C24] Trace: SGN-T196854 EST: SGN-E395528 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395529Length: 638 bp (836 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E395529 [] (trimmed) TCAGATCGAAAGGGGCAAGCGAAGAAGCAGCCAACATGGAGGGTTTTTTCTCTGAAGGAGTTGCACTCTGCTACGAATAATTTTAACTATGATAA
CAAGCTTGGAGAAGGTGGTTTTGGAAGTGTTTACTGGGGGCAGCTCTGGGATGGATCTCAGATAGCAGTCAAAAGGCTAAAGGTGTGGAGCAACA
AAGCTGAGATGGAATTTGCTGTTGAAGTTGAAATTCTGGCTAGAGTACGACACAAAAATCTTCTAAGTTTACGCGGTTACTGTGCAGAAGGCCAG
GAACGTCTGATCGTATATGACTACATGCCTAATTTAAGCTTGCTTTCTCATCTTCACGGCCAGCATTCTGCTGAAAGCCTTCTTGATTGGAAACG
CCGAATGAATGTTGCAATTGGATCAGCTGAGGGAATTGCCTATCTGCACCACCATGCAACCCCGCATATCATCCACAGAGACATCAAAGCAAGCA
ACGTGCTGCTCGATTCTGATTTCCAAGCCCAAGTTGCTGATTTTGGATTTGCAAAGTTCATCCCAGATGGTGCAACACATGTAACCACTAGAGTA
AAAGGCACTCTAGGCTATCTTGCACCAGAATATGCAATGTTAGGGAAGGCATCGGAGAACTGTGATGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395529] SGN-U565344 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196855 [Download][View] Facility Assigned ID: FA0AAD31BB12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0038 Quality Trim Threshold: 14.5