EST details — SGN-E395560

Search information 
Request: 395560Match: SGN-E395560
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183948Clone name: TUS-43-I2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183948 is on microarray TOM1 spot ID 1-1-7.1.19.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C2539 [cLEC-16-F7] Trace: SGN-T26902 EST: SGN-E205013 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395560Length: 446 bp (839 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E395560 [] (trimmed) ATCAAACCTTTTCCCTTATTAGAATATCATCGCATTCATAAACAGAGTACATTCACAAATCAAATAGAAAGCAGTTAAACACAAGATACTGATAC
ACAGAGATAGTAAATTAATCCGATCAGATCTAATCACTGTCGCTGCTGCTGCTACGATCATGTCCGTCATGTTTCTTCTCCTTTTTGTGTTTCTT
CTTCTTCTTCTTCTCTTTTCCATCCTTGTGATTCTCTCCACTTTCTTCTCCATGGATCTTATCTTTTATCTTCTCAACAAATCCTTCCTGATGCG
CAACCTTCTTGTGTCCTTCTCCCTTGGGTTCCTCTTTTGTGGGTTCTTCGTCCTTAAGGCCACCTCCGATGTGGAGTTTCTCTTCAATTTTGTGG
ATGATTCCTGCCATTGTTAGATCAGAAATGAGAAATTGAGTTTTTTTTTTTGGGGGGGGGTTGCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395560] SGN-U580212 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196886 [Download][View] Facility Assigned ID: FA0AAD31BE01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0150 Quality Trim Threshold: 12.5