EST details — SGN-E395807

Search information 
Request: 395807Match: SGN-E395807
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174453Clone name: TUS-18-M11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174453 is on microarray TOM1 spot ID 1-1-6.1.16.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23067 [cLED-4-G2] Trace: SGN-T49242 EST: SGN-E231473 Direction: 5' Facility: TIGR
Clone: SGN-C174453 [TUS-18-M11] Trace: SGN-T197201 EST: SGN-E395875 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395807Length: 491 bp (839 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E395807 [] (trimmed) CAGCTTAGATCCGCCATTGCTTAGTTGATTGACTATCTAAAGACGTCTGATTTTATATAAAAATATGTCATGTTTCAATGCAGGGAGTCATTAAT
AGACTTCTCCAAGGATGTGAAGAAACTGGGATTCACTTTACTTGAATTATTGTCTGAAGGTCTCGGTCTCGATCGTAGTTATCTCAAAGATTATA
TGGATTGTTTTCATCTTTTCTGTTCTTGCAACTACTACCCACCATGTCCTCAGCCAGAACTCACCATGGGCACCATTCAACATACCGATATTGGT
TTTGTAACGATCCTTCTACAAGATGATATGGGAGGGCTCCAAGTTCTTCACCAGAATCATTGGGTTGATGTTCCTCCTACACCCGGTTCTCTAGT
GGTGAATATTGGAGATTTTCTGCAGCTCTTGTGGGATGACAAGTACTTAAATGTCGAGCACAGAGCAATCTCAAAACATGTTGCATCAAGAATGT
TAATCACATGCTTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395807] SGN-U580508 Tomato 200607 Build 2 40 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197133 [Download][View] Facility Assigned ID: FA0AAD6AG06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0051 Quality Trim Threshold: 14.5