EST details — SGN-E395829

Search information 
Request: 395829Match: SGN-E395829
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174058Clone name: TUS-17-L24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174058 is on microarray TOM1 spot ID 1-1-1.4.17.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C6880 [cLEC-37-C16] Trace: SGN-T31191 EST: SGN-E208200 Direction: 5' Facility: TIGR
Clone: SGN-C174058 [TUS-17-L24] Trace: SGN-T197156 EST: SGN-E395830 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395829Length: 495 bp (823 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E395829 [] (trimmed) AAAAAAAAAAAAAAAAAAAAAAAACCCCTTTTTTTTTTTCCCCAAACCCTTTTTTTTTTTTCCGGAAAAAAAAAAAGGGGGGGGGGGGGGGGGGG
GTCCCCAGGGGGTTTTCCCCGGGTTGGGGGGGGCCCCCCCCCGGGGGGGGAAAAAAAAACCCCCCCCCCCCCCCCCCAAAAAAAAAAAGGGGGGG
GGGGGGGTAAAAAAAAAAAAGGGCCCCCCTTTCCCCCCCCCCCCCTTTTTTAAAAAAACCCGGGGGGGGGGGTCCCCCCCCCCGGGGGGGAAACC
CCGGGAAAATTTTTGGGGGGGGGGGGGAAAAAAGGGGGAAGAGGGGCCCCCCGGCCCAAAGGGGGGGGGGGGAAAATGGGGGGAAAAGGGGGCCC
CGCCCCCCCGGGGGGTTTTTACCCCCCGGGGGGGGGGGGGGGGGGGAGGGGGCCCGGGGGGGGGGGGGGGGGGGGGGGGGCCCCCCCCCCCCCCC
CCCCCCCGTGGGGGGCGCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T197155 [Download][View] Facility Assigned ID: FA0AAD5DF12FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.662 Expected Error Rate: 0.0217 Quality Trim Threshold: 14.5