Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E395869

Search information 
Request: 395869Match: SGN-E395869
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174367Clone name: TUS-18-I21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174367 is on microarray TOM1 spot ID 1-1-4.1.15.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C22959 [cLED-4-B4] Trace: SGN-T49500 EST: SGN-E231731 Direction: 5' Facility: TIGR
Clone: SGN-C174367 [TUS-18-I21] Trace: SGN-T197127 EST: SGN-E395801 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395869Length: 240 bp (829 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E395869 [] (trimmed) GTATTAATTAGTACTTAGATACTTTATTAAGACCCCTAAAAACATAACAATAACAACTAAGAGAAATAACATACAAAATAAATAGATGATGAGGG
GCACATAACTACTTCTATTTGCTTTACACTTTCAATCCAAATTTCCAACTTTTCCAATCCTCAAGTAAATAAGATAAATCACTTTTTTCTCACTC
TTCCCATCTTCATTCCAAGCACTTGCAAATTTTCTCACAACATCCTCCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395869] SGN-U580752 Tomato 200607 Build 2 98 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197195 [Download][View] Facility Assigned ID: FA0AAD6AE11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.868 Expected Error Rate: 0.0243 Quality Trim Threshold: 14.5