EST details — SGN-E395886

Search information 
Request: 395886Match: SGN-E395886
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174187Clone name: TUS-18-B9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174187 is on microarray TOM1 spot ID 1-1-8.2.16.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C7207 [cLEC-38-D15] Trace: SGN-T31691 EST: SGN-E209156 Direction: 5' Facility: TIGR
Clone: SGN-C174187 [TUS-18-B9] Trace: SGN-T199849 EST: SGN-E398523 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395886Length: 399 bp (910 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E395886 [] (trimmed) CTTGAATTGGAGAAATTCAAGTTCTTTGTTCATGTATTTCTCAACAACACAAGGAATATCCGAACGAAGAACTTGAATTGGAGAAATTCATCACT
CATACACTTCCATTTGCTGAAATCAATAAGGCTTTCGATTTAATGCTGAAGGGAGAAGGCCTTCGTTGCATCATCACCATGGCGGACTAAACTTT
CTGTCCTAGAAAAGGAGCTTCTACTGTTTGAGAAATAAGACCAATAAATTGTCACTGTCTTATTTTCCCTTTCGTGTTTGGTTGAGTTGTAACAT
TCCATCCATGTCTCTTCTTTTGTCTTTTGCTTAGATGTTGTGCTTTGCCATATCTCTTTCGATTCTTGTAAAAAATGCAAATTCTCTCTGTTTTA
TCTCAAGTATATTTACAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395886] SGN-U579420 Tomato 200607 Build 2 345 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197212 [Download][View] Facility Assigned ID: FA0AAD6CA05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0001 Quality Trim Threshold: 14.5