Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E395893

Search information 
Request: 395893Match: SGN-E395893
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174229Clone name: TUS-18-D3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174229 is on microarray TOM1 spot ID 1-1-6.4.16.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C7372 [cLEC-38-L15] Trace: SGN-T31708 EST: SGN-E209173 Direction: 5' Facility: TIGR
Clone: SGN-C174229 [TUS-18-D3] Trace: SGN-T197220 EST: SGN-E395894 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395893Length: 463 bp (876 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E395893 [] (trimmed) GAAACCAAATAGGGAAACTCTTTATATTAAAGAGCAATTTTTCGCAAATTTACATTAGATTTCAGTGTTTCCTCTGAAGTCTTAAGCTATGTACA
TCTCTACAGTCTACATATTTTGTATATAAAAGAATGATCATGAACTAATAAATGAAACAATTTAACCAGGGACAACAATTGAAACAAAAATCTCA
CTTTGAAACTAAATATGTAATGAAAGGAGGTAGGGCAGATACCCTAAGAGCAGGAACCTGTGCCGTCTCCTTTCTGATTCTTCACTCAGTATGAA
AATTCATTGCCTCTGAGGGATATATACTTTTTGACCCAAATCGAGATGTCCTCTAAGCAAGCCTGAGCTTTAGGCGTTTTCTGAAGCACGTAGAG
GGTAGCAAAGTCATGCACAGCATCCTTGTAATCAAGAAGAGGGGCATCGACATTCTCTCTTCGAAGGTCATGGGGGGGGGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395893] SGN-U594254 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197219 [Download][View] Facility Assigned ID: FA0AAD6CB02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0079 Quality Trim Threshold: 14.5