EST details — SGN-E395897

Search information 
Request: 395897Match: SGN-E395897
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174239Clone name: TUS-18-D13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174239 is on microarray TOM1 spot ID 1-1-4.4.16.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C7420 [cLEC-38-N7] Trace: SGN-T31572 EST: SGN-E209037 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395897Length: 455 bp (860 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E395897 [] (trimmed) AATTAATCATACTCGGAATAAAAAGATGGAAAACATGGGAAAATGAATACAATTTCTCAAGGGATTTTCAAAGGAGAATTCAAACAAACTGTCCC
TATAAACATAGGGCAATTAGTTTTTCTACAACTTAGTACCCTTCGGGCTTGTAAGCGATGAAACTGATGCACTGCACTTGACGAACATTGTCGAA
TCCGATGATACGGACCCATGCCTGTGGGTAATCCTTCTTTGCCTCCTGCACCTCATCCAAGACCTGGGTTGCATTCAGTGCACCCGAACATGGGC
AACTTCCACATGGTCCAGTATCTGCCATCGTACTATCCTGGTGACTTATGGTTCTCACGGTACACAAATCCGTGCTCAGTCTCGAATTCCAAGCA
AGGAACCCATCCATTTTTCGGGAGGGACTCAATTTCGCTGAACAATTGCTCGCCGGAAAAATCAAGGAAGGTACG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395897] SGN-U580869 Tomato 200607 Build 2 1124 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197223 [Download][View] Facility Assigned ID: FA0AAD6CB07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0091 Quality Trim Threshold: 20.5