Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E395914

Search information 
Request: 395914Match: SGN-E395914
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174293Clone name: TUS-18-F19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174293 is on microarray TOM1 spot ID 1-1-6.2.15.1 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C7848 [cLEC-40-H2] Trace: SGN-T32296 EST: SGN-E210232 Direction: 5' Facility: TIGR
Clone: SGN-C174293 [TUS-18-F19] Trace: SGN-T197241 EST: SGN-E395915 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395914Length: 690 bp (874 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E395914 [] (trimmed) ATCTCTTAATGCCTCAAATTAACATTTAATATTCGTTTTTCTCTATAAAATAACAGAATACCATAACAACATTAAGACATTCTATTGAAGTTTGA
CCAATCGTATTAAGACGACCCTACTCAACAAAAAAATAGCCTAAGCCTTGAAAAGAACGACTTAAGTGTTCTTTCATCGAGTATTATGATCAAGA
CGCGGGCGATAAATTTAAACCATGGTACTAGCTTGCAAATATGAAGATCAGCCAAACATTGTTTATCAAATCTTCTCATTAAAAAACTCAACTAG
CCTTTTCATCAATAGAGCAGCCTTCTCACAATTTGGTTCAAGCAAATGAAAAACATGATCCTCCCCTTGTGTCTCCATAATCTCAACCTCACCAT
TCCATCCACTCTTCTTCAATGCATCATAATAAGTCAAACTCCTCTCTCTTAGAAAATCTTTCTCCGCGGTAAAAACCATAACCTTTCGACAAATA
AGACTTGATAGTAACCTAAGATGAGCTGCTGGATTCAACCTAGGATCATCAAGTCCTTCACACTCTGGAAAAATAAACGAACAATACTCATCAAC
TTCATCGTTACCGAAAAATGGATGGATTAGTGCTATTCCAGCAATCTTAAAACCATCCCCTAGTGGCTTTTCACTAGCACTTGCTCTAANCACCA
TGTCATGTACAATATTTGCACCCGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395914] SGN-U584989 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197240 [Download][View] Facility Assigned ID: FA0AAD6CC10FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5