Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E395965

Search information 
Request: 395965Match: SGN-E395965
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174527Clone name: TUS-18-P13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174527 is on microarray TOM1 spot ID 1-1-4.4.16.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23172 [cLED-4-K9] Trace: SGN-T49407 EST: SGN-E231638 Direction: 5' Facility: TIGR
Clone: SGN-C174527 [TUS-18-P13] Trace: SGN-T197292 EST: SGN-E395966 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395965Length: 658 bp (872 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E395965 [] (trimmed) CTGAATAATATAAGATCAAGTAAATGTTTCTATTCAATTTGGTAGTTGAAATAATGTTTGACAGGAATCTGAGGAGGAAAACTTATAACAGTGAA
ACAATTGAGCATATAGAACAGTAAGTAATCACTAAATGGAGTAACAAAGAAATATCAATGTGTAACAGAAGAAGACCCTATTTCAGTCATTGGTG
GTGTGAGGTTTGGTGTAGAAGCTTCCGTGGATGGTCGAATCCCCGGATTCACTCTCCTAACGCCCTCTACCTTCTTTACTACTTCTGTCATTTTT
GGTCTCTGCTCTGGCATTCTGGATACGCCACTCAAACCTATTTGTAACATCTCCTCCATTTCTTCTTCTATATTTGGATACCTCAGAAGCTCCGC
GTCGAATACTTCATCAGTCCACTCCTCACGAACGACAGAATGTACCCACCTGACTAAGTGGACAATGTCGCGGGGGGCGGTGGCATGTGTAGGGG
ACTTTCCAGTGAGAAGTTCAAGTATTAGGACGCCAAAGCTGTAGACATCAGTGGCTTGAGATACTTTTCTTGAATCTGTAACTTCTGGAGGTTGA
TAACCAGCCGCTCGCACAATTGGTATAGCAATTGGACCCTTTTATATTTCCCCAAGCCCAACATTCATAAATACAACCGAAACCTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395965] SGN-U582034 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197291 [Download][View] Facility Assigned ID: FA0AAD6CH07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0125 Quality Trim Threshold: 14.5