EST details — SGN-E396012

Search information 
Request: 396012Match: SGN-E396012
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174330Clone name: TUS-18-H8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174330 is on microarray TOM1 spot ID 1-1-1.4.16.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C7976 [cLEC-40-O10] Trace: SGN-T32273 EST: SGN-E210209 Direction: 5' Facility: TIGR
Clone: SGN-C174330 [TUS-18-H8] Trace: SGN-T197339 EST: SGN-E396013 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396012Length: 368 bp (865 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E396012 [] (trimmed) AGAAGTTGCTTTTTTTTAATCTTAGGATCTGAAAAGCAATAAGCTGCTTTTAAAATGGTATTCTATTACATTCTCAAAAGCCTTCAAAGATAAAC
GAGTCGGCCTAACAGATACAACAGTTTCTGGCAACATAAATGATTTTGAAAGATTTAAATGGACGAAAACCACAAACTCAAAAATCAGCACGAAA
AGTCGAATTTTCGTACCATGCAATTAAAGGTAGGTTCTATGACTTCGGTTCATCAACCCATGTTGGGTGGTGGAGGTGGTGGGCGCATTCCTTGG
CCTTGCATCTGTTGTTGACCTGGAAAACCTTGTGGAGGCATCATTGGAGGTCTACCCTTTTTTCCACCTGGAGTGAAATTAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396012] SGN-U579036 Tomato 200607 Build 2 45 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197338 [Download][View] Facility Assigned ID: FA0AAD6DD04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0023 Quality Trim Threshold: 14.5