EST details — SGN-E396099

Search information 
Request: 396099Match: SGN-E396099
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174691Clone name: TUS-19-G9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174691 is on microarray TOM1 spot ID 1-1-8.3.15.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23424 [cLED-5-F5] Trace: SGN-T49844 EST: SGN-E231228 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396099Length: 213 bp (948 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E396099 [] (trimmed) CCGTGAGAAAACAAAAATGAAGCATCCAGTAGCAGAAGCGAACGAGTTGAGTCCGTTCGGTTCACTGAGTCAATCCGAGTTCTACTCTCACCACT
CAGTAACTCACAACTCCGAATTCATTACAAATTCACGAGGCTTAAAGCTTTTCACTCAATGGTGGTCCCCACTTCCTCCGACGAAAATCATCGGC
GTCGTTTGTGTCATCGATGGATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396099] SGN-U566786 Tomato 200607 Build 2 49 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197425 [Download][View] Facility Assigned ID: FA0AAD7AD05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0051 Quality Trim Threshold: 14.5