EST details — SGN-E396260

Search information 
Request: 396260Match: SGN-E396260
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182643Clone name: TUS-40-B17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182643 is on microarray TOM1 spot ID 1-1-8.2.5.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C123463 [cTOC-11-O24] Trace: SGN-T137880 EST: SGN-E324955 Direction: 5' Facility: TIGR
Clone: SGN-C182643 [TUS-40-B17] Trace: SGN-T191840 EST: SGN-E390514 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396260Length: 544 bp (890 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E396260 [] (trimmed) TTAATAAATGTGTGGTACATTTCAAGTAAAACAACAAAATGTCAAGAAAAAGGTAACTCACTATTGGCAAATTCCTTTCATTTCAACAATAGTAG
AATAACCATAAATAGTTCAACTACAAAACATCTCAAAATCCAACAATCATTCAAATATCCCATTGAAGATTGAAAATCCACAAAACTTGAGTTCA
TCTCAACATCAATAACAAACTTGAGTTCTTGTTCACATTGTTTTACCCCAAACGGAACATCGATTGTTGACACCAAACCATAAGAGTAACATAAA
TTTTGATTCCCCCATGCCCCAAATCTCCTTCCCATTTTCCTATAAAACCATTGAGAGAATTGAAGTTCACCTGTTAGATTGTTACCATATAGGTA
AATAGCACTTACATTAGGCAAATCTTCAAGATTCTTTGGGATTTTACCATTGAGTTTATTGTCATTAAGTCCCAAAAATCTTAACTTTTTTAACT
CTGCTATAGACTTAGGTATCTCACCTGTCAAATTCATGTTTGACAAATCCAAAGTTGTTAACTTTATCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396260] SGN-U576476 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197586 [Download][View] Facility Assigned ID: FA0AAD28CA09FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.920 Expected Error Rate: 0.0043 Quality Trim Threshold: 14.5