EST details — SGN-E396263
| Search information |
| Request: 396263 | Match: SGN-E396263 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C182771 | Clone name: TUS-40-H1 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C182771 is on microarray TOM1 spot ID 1-1-8.4.6.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C132318 [cTOD-2-E5] | Trace: SGN-T141825 | EST: SGN-E329211 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C182771 [TUS-40-H1] | Trace: SGN-T191858 | EST: SGN-E390532 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E396263 | Length: 149 bp (870 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E396263 [] (trimmed)
CACAAGTAAAAAAGAAAATTTATTTGGATTAAATGACTGTTGACAAGAAAAACAAGTTGAATTCAAGAAAAGTAATGGGAGCACTCAAATATAGA
GTCTTGTAACATCACTTCAAAAACAAAATTATTTTTCAGTCTTGCCCTTTAACT
GTCTTGTAACATCACTTCAAAAACAAAATTATTTTTCAGTCTTGCCCTTTAACT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E396263] | SGN-U584356 | Tomato 200607 | Build 2 | 4 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T197589 [Download][View] | Facility Assigned ID: FA0AAD28CD01FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.846 | Expected Error Rate: 0.0127 | Quality Trim Threshold: 14.5 |
Working
