EST details — SGN-E396263
Search information |
Request: 396263 | Match: SGN-E396263 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C182771 | Clone name: TUS-40-H1 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C182771 is on microarray TOM1 spot ID 1-1-8.4.6.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C132318 [cTOD-2-E5] | Trace: SGN-T141825 | EST: SGN-E329211 | Direction: 5' | Facility: TIGR |
Clone: SGN-C182771 [TUS-40-H1] | Trace: SGN-T191858 | EST: SGN-E390532 | Direction: 5' | Facility: INRA |
Sequence |
Sequence Id: SGN-E396263 | Length: 149 bp (870 bp untrimmed) |
Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E396263 [] (trimmed)
CACAAGTAAAAAAGAAAATTTATTTGGATTAAATGACTGTTGACAAGAAAAACAAGTTGAATTCAAGAAAAGTAATGGGAGCACTCAAATATAGA
GTCTTGTAACATCACTTCAAAAACAAAATTATTTTTCAGTCTTGCCCTTTAACT
GTCTTGTAACATCACTTCAAAAACAAAATTATTTTTCAGTCTTGCCCTTTAACT
Unigenes |
Current Unigene builds | |||||
[SGN-E396263] | SGN-U584356 | Tomato 200607 | Build 2 | 4 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T197589 [Download][View] | Facility Assigned ID: FA0AAD28CD01FM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.846 | Expected Error Rate: 0.0127 | Quality Trim Threshold: 14.5 |