EST details — SGN-E396356

Search information 
Request: 396356Match: SGN-E396356
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185952Clone name: TUS-48-L14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185952 is on microarray TOM1 spot ID 1-1-3.4.7.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396356Length: 124 bp (932 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E396356 [] (trimmed) AGGTACCATTTACAAATGTAGAATACTGAAGCTCTTTTTTTTTTTTTTATGGAAAAACTTGCGAGTAAGCTCTTTTTTGTAATGACTGTAATTTG
TTGAAGGATGTCCTGTTCTCTGTTCCCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396356] SGN-U575923 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197682 [Download][View] Facility Assigned ID: FA0AAD36DF07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 1.0000 Quality Trim Threshold: 14.5