EST details — SGN-E396474

Search information 
Request: 396474Match: SGN-E396474
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185991Clone name: TUS-48-N5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185991 is on microarray TOM1 spot ID 1-1-4.2.7.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C69717 [cLER-12-G12] Trace: SGN-T94488 EST: SGN-E283521 Direction: 5' Facility: TIGR
Clone: SGN-C185991 [TUS-48-N5] Trace: SGN-T197761 EST: SGN-E396435 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396474Length: 670 bp (908 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E396474 [] (trimmed) AGTAAAGAAACAAATATCATTAATATAGTTCTTGTAAACTTGATTGAAATTCGAATTAATCATACACGGAATAAAAAGATGGAAAACAAGGGAAA
ATGAATACAATTTCTCAAGGGAAAACCCAAAGGAGAATTCAAACAAACTGTCCCTATAAACATAGGGCAATTAGTTTTTCTAGAACTTAGTATCC
TTCGGGCTTGTAAGCGATGAAACTGATGCACTGCACTTGACGAACATTGTCGAATCCGATGATACGGACCCATGCCTGTGGGTAAGCCTTCTTTG
CCTCCTGCACCTCAGCCAAGACCTGGGTTGCATCAGTGCACCCGAACATGGGCAACTTCCACATGGTCCAGTATCTGCCATCGTAGTATCCTGGT
GACTTATGGTTCTCACGGTACACAAATCCGTGCTCAGTCTCGAATTCCAAGCAAGGAACCCATCCATTTTTCAATAGGTACTCAATTTCGCTGAG
CAATTGCTCGTCGGACAAATCAGGAAGGTACGACAGAGTCTCGTACTTCTTCATGTTAATTGGTGGCCACACCTGCATGCAACTGACTCTTCCAC
CGTTGCTAGCAATGGAGGTAATGTCAAGGTTTTGCTTCCTTGAAACAGGGAAAGAAGCGGTGGACTTGAGTCCAGTGAAGGGTGCAACCATGCTA
GCTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396474] SGN-U580869 Tomato 200607 Build 2 1124 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197800 [Download][View] Facility Assigned ID: FA0AAD36CG03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0014 Quality Trim Threshold: 14.5