EST details — SGN-E396732

Search information 
Request: 396732Match: SGN-E396732
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184069Clone name: TUS-43-N3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184069 is on microarray TOM1 spot ID 1-1-6.2.19.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C5903 [cLEC-33-I8] Trace: SGN-T30245 EST: SGN-E206973 Direction: 5' Facility: TIGR
Clone: SGN-C184069 [TUS-43-N3] Trace: SGN-T198059 EST: SGN-E396733 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396732Length: 460 bp (881 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E396732 [] (trimmed) ATAAGCTGAAATTGAATTTCAACAATATTATTCTTACAAGCTCAAAGTTACAATTTCACATCCTAGAAAAATTATCACTCAAAACATGAAGAGGG
AAAAAAAAGGGGTGAGGGGTCAGTTGTGCATACATCAGTCTTTTTCCTATACAGTCAGAACATATCTCATTCCTTTATGCAGCTTCCATATAATC
ATATATATACAAGCTCAATTGAACCCTACCGCGTCTGGTATATAACTGGAGAAGAGTAAAGGGGCGGTTCTATCATCCACTGAGTTATGAACAGT
GCACTATTGACCCTCGAGGACTTCTCGGTTAATAAAAGAAAACAAAAAAATTTTTTCAATAACATACAGCAATATTACTTGAGCATTCTATCTCA
AATGCCCTTTTTTTGTTTCATCTAATTATCTATCTTTTATAAACAACATCGCCTTGGTCCTGATAATTCCATTGCTAGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396732] SGN-U575202 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198058 [Download][View] Facility Assigned ID: FA0AAD31CG02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0064 Quality Trim Threshold: 14.5