EST details — SGN-E396762

Search information 
Request: 396762Match: SGN-E396762
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183792Clone name: TUS-43-B14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183792 is on microarray TOM1 spot ID 1-1-3.2.19.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C6665 [cLEC-36-D10] Trace: SGN-T31001 EST: SGN-E207413 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396762Length: 251 bp (887 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E396762 [] (trimmed) GGTACCGGGCCCCCCCCCGAGCTTTTTTGTTTATTTTTTCTTTTGACCCCAGCCTAATGGAAATGTATTGGAGTATTTACAAATGTGCTAGTGAA
GTAGGGTATGCTAACTATAGGGATTTGTGGATCTTTGAAAATTGGACTCTTTCATCTCTGAAATTATCAAAGAATTATTGGTTTTTAAAATGTAA
CATCTTTTCTATTTCTTTTATGTGTTACCACTTTCATTTACACGATTAACTAAACTTATAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396762] SGN-U595472 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198088 [Download][View] Facility Assigned ID: FA0AAD31DA07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.906 Expected Error Rate: 0.0175 Quality Trim Threshold: 12.5