EST details — SGN-E396918

Search information 
Request: 396918Match: SGN-E396918
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184179Clone name: TUS-44-B17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184179 is on microarray TOM1 spot ID 1-1-8.2.16.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C22652 [cLED-38-O16] Trace: SGN-T58168 EST: SGN-E244556 Direction: 5' Facility: TIGR
Clone: SGN-C184179 [TUS-44-B17] Trace: SGN-T198245 EST: SGN-E396919 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396918Length: 297 bp (870 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E396918 [] (trimmed) AGGACGTATGGAGTATTTTTAAAAAAAAAACTCCAAAAACGAATACCTTATAAACAAAGTTTATAACACTGAATTTTTCTTCCGAAACGTTCAAC
TGCCAAACAAATCTCTAGCAAATACTTTCAATAAAAAAAAATAAAGAATTTTGAGGTAAAGATAAAAAAAAAAGTGGATGTATACAATTATTTAA
GCTCTATGGAAATCATTGTGCAATGGTGAATTTGGAGTTAATTTCTTATGTAGACTTTTTGTATTGGTATTTGTTTTGTTGAGTAATTCCCTTTG
AGGACTTCGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396918] SGN-U569230 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198244 [Download][View] Facility Assigned ID: FA0AAD32CA09FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.889 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5