EST details — SGN-E396979

Search information 
Request: 396979Match: SGN-E396979
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184375Clone name: TUS-44-J21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184375 is on microarray TOM1 spot ID 1-1-4.2.16.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C69507 [cLER-11-A19] Trace: SGN-T94129 EST: SGN-E279377 Direction: 5' Facility: TIGR
Clone: SGN-C184375 [TUS-44-J21] Trace: SGN-T198304 EST: SGN-E396978 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396979Length: 580 bp (841 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E396979 [] (trimmed) AAAATGGCAGCTATTCAGCAAAGTCTTTCTACTTCAATCTCTTCATCAGCATCTACTTTTCTGGGTCAGAACAAACTCCGTTTCAGGAATCAGAA
TGTGTCAATGCCAGGCAAAACCAGTGGTATTGTCAGATGTGTTGCAACACCCTCTACGGAGAAAACTTCTTACAAGACACAGGTCTCCCGCAATG
AAAACTTAGCGAAACTTCAAGCTGGTTATCTGTTTCCTGAGATCGCAAGAAGGAGATCTGCACACATGTTGAAACATCCTGATGCTCAAATTATA
AGCCTTGGAATTGGTGACACTACCGAGCCCATTCCTGAAGTCATAACTTCTGCCATGGCAAAGAGAGCACATGAACTGTCAACATTAAATGGTTA
CAGTGGTTATGGTGCTGAGCAAGGAGAAAAACAACTTAGAGCCTCCATTGCTTCTACCTATTATGCAAATGTTGGACTAGAAGAAAATGAGATCT
TCGTTTCTGATGGTGCCAAAAGTGATATATCTCGACTTCAGGTTCTTTTTGGATCTAATGTGAGTATGGCTGTGCAAGATCCATCATACCCGGCT
TATGTGGACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396979] SGN-U585208 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198305 [Download][View] Facility Assigned ID: FA0AAD32CE11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0006 Quality Trim Threshold: 12.5