EST details — SGN-E397005

Search information 
Request: 397005Match: SGN-E397005
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184469Clone name: TUS-44-N19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184469 is on microarray TOM1 spot ID 1-1-6.2.16.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184469 [TUS-44-N19] Trace: SGN-T198330 EST: SGN-E397004 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397005Length: 403 bp (878 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E397005 [] (trimmed) GGAAAATGGGACCCTTAAGAGCCATCTGTATGGTTCGGATATGCCTAGTATGAGCTGGAAACAGAGGCTGGAGATATGTATTGGGGCAGCCAGAG
GTCTACACTACCTTCATACTAGCTACGCCAAAGCAGTTATACATCGTGATGTCAAATCAGCAAACATATTGCTTGATGAGAATATGATGGCAAAA
GTAGCTGATTTCGGACTTTCTAAGGCAGGACCCGAGCTCGATCAAACTCATGTTAGCACGGCAGTGAAAGGGAGCTTCGGGTACCTAGATCCCGA
ATATTTCAGGAGGCAGCAATTGACTGAGAAAAGTGATGTTTACTCTTTTGGTGTTGTTCTGTTTGAAGTTCTTTGTGCTATGCCTGTTATCGATC
CNTCTCTTCCAAGGGAGATGGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397005] SGN-U577087 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198331 [Download][View] Facility Assigned ID: FA0AAD32CG10RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5