EST details — SGN-E397080

Search information 
Request: 397080Match: SGN-E397080
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184360Clone name: TUS-44-J6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184360 is on microarray TOM1 spot ID 1-1-3.2.16.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C75229 [cLES-13-F11] Trace: SGN-T100277 EST: SGN-E285964 Direction: 5' Facility: TIGR
Clone: SGN-C184360 [TUS-44-J6] Trace: SGN-T198407 EST: SGN-E397081 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397080Length: 682 bp (871 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E397080 [] (trimmed) GCAAGGATAAAGAACAAGGAGTGCCCTTCTTTCATTATTGTCCTTTCCCTGTACAAACTTTCTATCCGAAAAGAGTAAAGATAAAACTAGAAACA
AGCTAGTGCAAAGCTGTAGCGTTTATCCAATACAATGTAACCTGACATGCTACTTTCCTGATTGGGAGAAGTTCTCTGTGTTCTTGCCCCCCTCG
CAACCCAACCAACCGATTGGGATCACAGAAGAGGAACTTTGCCAGCAAGTTCGTCATGGTTGACTCTCCTACTTGATGTATTGCGACATCCACTT
GAAACCCTCACCATATCCCATCTTGCGCACAATGCTGCACATAAACACCTCAATTGGACGGACATTGGTACCAGCAAGGTTGATGTTACCCTTGC
CAGTGGTCACACCAGTTAGGCCCAAGTGATAACGCAGCTCATCTTCTGAGGCAGCATATGGTATATCAATCTTGTTTCCCAAAATGAGAAATGGG
ACATTTGTTAACGACTCATCTGACAGAAGCCCATCCAATTCCTTCTTTGCCTCTGGAAACCTCTCTCTGTCATTTGCGTCCACAAAATAAACAAC
AGCGTCCACCTTGGCATAATAGTCTCTCCAGACTCTTCTAGCAATCTGGTGTCCCCCTAAATCAAAAGCCTTGAACTTGATATTCCCAATACTCA
ACTCCTCCGATGTGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397080] SGN-U581221 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198406 [Download][View] Facility Assigned ID: FA0AAD32DE03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5