EST details — SGN-E397223

Search information 
Request: 397223Match: SGN-E397223
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184579Clone name: TUS-45-C9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184579 is on microarray TOM1 spot ID 1-1-8.3.14.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C87430 [cLET-4-J12] Trace: SGN-T103335 EST: SGN-E289664 Direction: 5' Facility: TIGR
Clone: SGN-C184579 [TUS-45-C9] Trace: SGN-T198459 EST: SGN-E397133 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397223Length: 412 bp (902 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E397223 [] (trimmed) ATGACGACATTCAACCAAAATTTGGAGATTAAGCAACAAAATCGAGATTAGCATTAGCAAGTCTATGAGTATCTTATTTAATTGTAGTCTTAAGA
TTAAACATAAACTGGTAGAAGCAACACAACAACCAATTACGGTTAACCCTAGAACTCGACCCGACACGACCCGACCAAAGCAGTAGAGATAGTTT
GAAATTAAAAACAAAGCCTAAAACGGCGACTCAAATACATAAAAGACTGATAAAACTAGATCATCATCATCATCAGATCTAGAGTTGACCGCAGT
CAGCAATAACCACAGGCTTGGAGCACCTTCCAGAGCTAGATCCAACAGCCTCTGCCTTCTTAATCACATCCATGCCTTCAACAACTTGTCCAAGC
ACGACGTGCTTTCCGTTGAGCCACTCAGTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397223] SGN-U577630 Tomato 200607 Build 2 444 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198549 [Download][View] Facility Assigned ID: FA0AAD33AB05FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5