Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E397275

Search information 
Request: 397275Match: SGN-E397275
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184524Clone name: TUS-45-A2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184524 is on microarray TOM1 spot ID 1-1-7.1.14.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81546 [cLET-17-B4] Trace: SGN-T107024 EST: SGN-E294969 Direction: 5' Facility: TIGR
Clone: SGN-C184524 [TUS-45-A2] Trace: SGN-T1832 EST: SGN-E378734 Direction: 5' Facility: Giov. Lab
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397275Length: 572 bp (874 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E397275 [] (trimmed) CAAGCAACAAAATCGAGATTAGCATTACCAAGTCTATGAGTATCTTATTTAATTGTAGTCTTAAAATTAAACATAAACTGGTAAAAGCAACACAA
CAACCAATTACGGTTAACCCTAAAACTCCACCCGACACGACCCGACCAAAGCAGTAAAAATAGTTTGAAATTAAAAACAAAGCCTAAAACGGCGA
CTCAAATACATAAAAAACTGATAAAACTAAATCATCATCATCATCAAATCTAAAGTTGACCGCAGTCAGCAATAACCACAGGCTTGGAGCACCTT
CCAAAACTAAATCCAACAGCCCCTGCCTTCTTAATCACATCCATGCCTTCAACAACTTGTCCAAACACAACGTGCTTTCCGTTGAGCCACTCAGT
CTTAGCGGTACAAATGAAAAACTGAAAACCGTTGGTTCCAGGTCCAGCATTAGCCATGGAAAGGATTCCAGGGCCGGGGTGCTTCTTAACGAAGT
TCCCATCGTTGAATTTGGCTCCATAAATCGACTCTCCTCCGGTCCCGTTTCCGGCGGTGAAATCACCTCCTTGACACATGAACCCTGGGATCACA
CG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397275] SGN-U577630 Tomato 200607 Build 2 444 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198601 [Download][View] Facility Assigned ID: FA0AAD33BA01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0166 Quality Trim Threshold: 14.5