EST details — SGN-E397340

Search information 
Request: 397340Match: SGN-E397340
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184613Clone name: TUS-45-D19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184613 is on microarray TOM1 spot ID 1-1-6.4.14.15 [Order] [Tomato Microarray Database]
See unigene SGN-U579080 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C77142 [cLES-20-B16] Trace: SGN-T102288 EST: SGN-E290609 Direction: 5' Facility: TIGR
Clone: SGN-C184613 [TUS-45-D19] Trace: SGN-T198667 EST: SGN-E397341 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397340Length: 424 bp (869 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E397340 [] (trimmed) CTAAAAATTAGGAATGTATAGAACAAAATATAAAATCTTAAAAGCTAGTCTTTCTTAGGTTCACATAGCAGTTACTTCCAAAAGTTAAAACATAA
ATCAAAATTATCCCATTACATCATTTAACTGAAGGGAGATGCAAATCAAAAAGCTCTAATGCCATATGTCTTCTACCAGCACCAAATGTAGAGGT
CCTCGTAGAAACTCGTATTCAAGATTTTTAACGGTACTTGATGAAGCCAATTTCCTTGGCATTGCTGCGGAAGCACTGTCTGCAACACATGAGTC
CATACTTTCTAATAATTGCATGAGGATTACCACACACACGGCATGTGCGAGAGCCAGGGCCGTAGTTCTTTGGGTGAGCGTTCCAGATGTTAGAG
TGACCCATCTTCACAGAAAAGCGAGGCTGCGCGATGTGTTTGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397340] SGN-U579080 Tomato 200607 Build 2 130 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198666 [Download][View] Facility Assigned ID: FA0AAD33CB10FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0006 Quality Trim Threshold: 12.5