EST details — SGN-E397341

Search information 
Request: 397341Match: SGN-E397341
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184613Clone name: TUS-45-D19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184613 is on microarray TOM1 spot ID 1-1-6.4.14.15 [Order] [Tomato Microarray Database]
See unigene SGN-U579080 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C77142 [cLES-20-B16] Trace: SGN-T102288 EST: SGN-E290609 Direction: 5' Facility: TIGR
Clone: SGN-C184613 [TUS-45-D19] Trace: SGN-T198666 EST: SGN-E397340 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397341Length: 327 bp (906 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E397341 [] (trimmed) TGCAAACACATCGCGCAGCCTCGCTTTTCTGTGAAGATGGGTCACTCTAACATCTGGAACGCTCACCCAAAGAACTACGGCCCTGGCTCTCGCAC
ATGCCGTGTGTGTGGTAATCCTCATGCAATTATTAGAAAGTATGGACTCATGTGTTGCAGACAGTGCTTCCGCAGCAATGCCAAGGAAATTGGCT
TCATCAAGTACCGTTAAAAATCTTGAATACGAGTTTCTACGAGGACCTCTACATTTGGTGCTGGTAGAAGACATATGGCATTAGAGCTTTTTGAT
TTGCATCTCCCTTCAGTTAAATGATGTAATGGGATAATTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397341] SGN-U579080 Tomato 200607 Build 2 130 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198667 [Download][View] Facility Assigned ID: FA0AAD33CB10RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0003 Quality Trim Threshold: 14.5