EST details — SGN-E397553

Search information 
Request: 397553Match: SGN-E397553
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184915Clone name: TUS-46-A9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184915 is on microarray TOM1 spot ID 1-1-8.1.12.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10870 [cLEC-6-I12] Trace: SGN-T23964 EST: SGN-E202303 Direction: 5' Facility: TIGR
Clone: SGN-C184915 [TUS-46-A9] Trace: SGN-T198878 EST: SGN-E397552 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397553Length: 506 bp (867 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E397553 [] (trimmed) GCTTTCACCATGTTGAAAAGTGTTGTCGCATGGAGAAAAGAATTCAAGATTGATGAACTCTTGGATGAGAAAGAATTAGGACAAGGACTTGAAAA
AGTTGTTTACAATCACGGAGTAGACAAAGAAGGTCACCCTGTATGTTACAATGCATTTGGTGAGTTCCAAGACAAAGAATTGTACCAAAACACTT
TTGCTGATGACAAAGAGAAACTCACCAAATTCCTCAGATGGAGAATTCAATTCATGGAGAAATCCATCAGGAATCTTGATTTTAGCCCTGATGGT
ATCAACACTTTTGTTCAAGTTCTTGATCTGAAGAATTCACCTGGACTCTTCTTTTACAAGAAAGAACTTCGCCAAGCCACCAATCGTGCCCTTCT
ATTACTCCAGGATAATTACCCTGAATTTGTTGCCAAGCAGGTGTTCATCAATGTTCCATGGTGGTACCCAGCTTACTACAGGATGATTAATGCAT
CTTTCACTACAAGGACCAAGAGCAAGTTTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397553] SGN-U579616 Tomato 200607 Build 2 45 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198879 [Download][View] Facility Assigned ID: FA0AAD34AA05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5