EST details — SGN-E397763

Search information 
Request: 397763Match: SGN-E397763
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185035Clone name: TUS-46-F9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185035 is on microarray TOM1 spot ID 1-1-8.2.12.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72215 [cLER-1-I12] Trace: SGN-T91918 EST: SGN-E280364 Direction: 5' Facility: TIGR
Clone: SGN-C185035 [TUS-46-F9] Trace: SGN-T199028 EST: SGN-E397702 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397763Length: 350 bp (866 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E397763 [] (trimmed) ATGAAATTCGATAAAAGGCATAAATACTTCAATTACCTTTCAAGTTTACAAAATATTAGCTACTATGAAATTTTATCCTCTTCTTATACACTGAG
TTTGTCCATTTCCCTTCTTAGTGCATTAGCCCTCACCAAACTTCCAATGGTATTCACAGCAAGCTTCAAGTCTTCAATGGGGTTTCCTGGTGCAA
CTTTCTTGTACAAATAGCTGTCGAATGTCATCTTCTGCACATACTCATCAGCGCACATCTCCACGAAAGCTTCTCTTGCTGGATTCGACCTGTAA
AATACCTTCTGCAAGATATCAAGCACCTTGTATGTTGGCCAGTAAGTCTTGTCCCATTTCTCCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397763] SGN-U564570 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199089 [Download][View] Facility Assigned ID: FA0AAD34CC05FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0021 Quality Trim Threshold: 12.5