EST details — SGN-E397776

Search information 
Request: 397776Match: SGN-E397776
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185139Clone name: TUS-46-J17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185139 is on microarray TOM1 spot ID 1-1-8.2.11.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C70073 [cLER-13-H6] Trace: SGN-T94834 EST: SGN-E284140 Direction: 5' Facility: TIGR
Clone: SGN-C185139 [TUS-46-J17] Trace: SGN-T1873 EST: SGN-E378235 Direction: 5' Facility: Giov. Lab
Clone: SGN-C185139 [TUS-46-J17] Trace: SGN-T200101 EST: SGN-E398775 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397776Length: 652 bp (881 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E397776 [] (trimmed) ATCCAAAAATTATATTAACTAGTGAAATAAAGATAAATCTTATTACATTCAACTTTAATATATTTCAATTGAATTTAGAAAAATCCAATTTTTAT
TGCCACACAAAATCTTGAAATTCATTTGAGGTGTACTCATTTTGAAGCATCAACAGGCTGAATGTAGGCTCGATAACGGATAAGCAATTCATCTC
TTGAAGGAAAATATTCCTTGTTTTGGATGCAATATTCATCTCTCCAAGCACAAAAATTTGGAAATTTTTCACTTGTCGCTAAAACGACTCCAGAT
ACTTCTTCAAGAATTCCCAAATAAAGTGCTGCACCATTTGCAACAATATCAGCAAATCCAAATTTGTCACCAACAAAGTACTTCTTGTCCTTGAA
CTCATTATCAAGAATTTTCAACATCTCATAAGCTTCCTCTTTAGCTTTCTCTTGTTCCTCTCCTTTGAAGAAGAAACTTTTCCACACTGCTGACC
CCTTATCATCGACATATTTAGCCCAAAAACGCGCTAAAGCTCGATCATAAGGGTCTTTAGGCAAAATGGAAGGGCCTTCAAATGCCTCATCAATG
TATTCAAGAATGACCATAGACTCACAAATGGGCTTGCCATTGTGAATTANCACTGGAATTTTCTTGTGAATTGGATTTGATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397776] SGN-U579357 Tomato 200607 Build 2 59 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199102 [Download][View] Facility Assigned ID: FA0AAD34CE09FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0061 Quality Trim Threshold: 14.5