EST details — SGN-E398005

Search information 
Request: 398005Match: SGN-E398005
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182147Clone name: TUS-38-N1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182147 is on microarray TOM1 spot ID 1-1-8.2.10.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C80772 [cLET-13-F3] Trace: SGN-T105804 EST: SGN-E293961 Direction: 5' Facility: TIGR
Clone: SGN-C182147 [TUS-38-N1] Trace: SGN-T194726 EST: SGN-E393400 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398005Length: 438 bp (855 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398005 [] (trimmed) TTTCAAAAGTATATTACGAAGGGATATGTCTCTGAGACTGAATCTGGAAAGAGACTTGCTCAGGTTGTGAGTGATCCAAGCTTGACAAAATCAGG
TGTCTACTGGAGCTGGAACAAAGACTCAGCTTCTTTCGAAAACCAGTTGTCCGAAGAAGCAAGTGATGCAGAGAAAGCGCGTAAAGTGTGGGAAG
TCAGTGAGAAACTCGTTGGTTTGGCTTAAATTTTGAACTAACCTTAGTCATCGTCGATGAAAACAGGAAAAATGACTTCGCGAGTGAGAATTTGT
AACCGAAATTTCTAGGATGTTGTAAAGAGAAGTGTCATTGTAGTTAGGATTGAAAATAAAGATCACTCAACTTGTTTTGTTTTGTGTTTGGAAAA
TGTCACTAATTTGCCTTTGAAGTTAAATGAAGTGATGGTTCATGAGCATTGTTCAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398005] SGN-U580321 Tomato 200607 Build 2 88 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199331 [Download][View] Facility Assigned ID: FA0AAD26CG01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.926 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5