Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E398007

Search information 
Request: 398007Match: SGN-E398007
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182203Clone name: TUS-38-P9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182203 is on microarray TOM1 spot ID 1-1-8.4.10.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81404 [cLET-16-D8] Trace: SGN-T106629 EST: SGN-E292496 Direction: 5' Facility: TIGR
Clone: SGN-C182203 [TUS-38-P9] Trace: SGN-T194736 EST: SGN-E393410 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398007Length: 539 bp (886 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398007 [] (trimmed) GCAATTTCAGAAGATTCTTAGGTACATAAGAGAAGGCCGTGACAGCTCTGCCACCCTTGAATGTGGTGGTGATAGAATTGGCTCCAAAGGCTACT
TTATTCAGCCCACAGTGTTCTCAAATGTCAAGGAGGACATGTCGATAGCACAGGATGAGATTTTTGGTCCAGTGCAATGTGTCTTCAAATTCAAG
GATATTGGCGAAGTAATAAAGAGAGCAAACAACACTCGCTATGGTCTAGCAGCAGGAGTTTTCACAAAGAACATCGACACAGCAAACACCTTGAC
CCGAGGATTGAGAGCTGGAACGGTGTGGGTTAACTGCTACGATATATTTGATGCTGGAATTCCTTTTGGAGGGTACAAGATGAGTGGCATGGGCA
GGGAAAAGGGTATTTACAGCCTTAACAACTACTTACAAGTGAAGGCTGTTGTTACTCCATTGAAGAATCCAGCTTGGATATAGATTGGGCACCCC
TGATTTTAAAATCATAGTACTACTGTTTTTGTAAAATGACATGGTTGTTTACATGACATTGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398007] SGN-U572014 Tomato 200607 Build 2 91 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199333 [Download][View] Facility Assigned ID: FA0AAD26CH05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0097 Quality Trim Threshold: 12.5