EST details — SGN-E398049

Search information 
Request: 398049Match: SGN-E398049
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182220Clone name: TUS-39-A2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182220 is on microarray TOM1 spot ID 1-1-7.1.8.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C18172 [cLED-22-E3] Trace: SGN-T54237 EST: SGN-E238171 Direction: 5' Facility: TIGR
Clone: SGN-C182220 [TUS-39-A2] Trace: SGN-T1709 EST: SGN-E378307 Direction: 5' Facility: Giov. Lab
Clone: SGN-C182220 [TUS-39-A2] Trace: SGN-T194753 EST: SGN-E393427 Direction: 3' Facility: INRA
Clone: SGN-C182220 [TUS-39-A2] Trace: SGN-T194754 EST: SGN-E393428 Direction: 5' Facility: INRA
Clone: SGN-C182220 [TUS-39-A2] Trace: SGN-T199375 EST: SGN-E399497 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398049Length: 348 bp (865 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398049 [] (trimmed) AATTGCAATATATAAAAAGTAAAGCAACATAAATGTGTAGCAACACACTTATTCTACCCTCCCTTCATTTGTACAGCTATTCTTACAAAAGCCTT
TTGGTACAGTTTACAACATGATTCGGGATTGATTTGTGTTTGTTACCAACTACATATAAAAGTTTTTGTATCAATACTTAAATCTTTTCTTATAA
AAAAAAATTTCATATATCTGCTCCAATGGAAAAACAATAACAACAACCTACTGGACAAAACTTATATTGATGGTGATCTTTTCCAACTAAGGAAC
TCAAAACAAATGAAAAAACCTTGCAAGCTTGCTATTAATAAAACAAATGAACCAACGCCCCGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398049] SGN-U581827 Tomato 200607 Build 2 94 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199375 [Download][View] Facility Assigned ID: FA0AAD27BA01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.894 Expected Error Rate: 0.0100 Quality Trim Threshold: 14.5