EST details — SGN-E398079

Search information 
Request: 398079Match: SGN-E398079
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183531Clone name: TUS-42-G17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183531 is on microarray TOM1 spot ID 1-1-8.3.1.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14725 [cLEC-8-G10] Trace: SGN-T25135 EST: SGN-E200046 Direction: 5' Facility: TIGR
Clone: SGN-C183531 [TUS-42-G17] Trace: SGN-T194935 EST: SGN-E393609 Direction: 3' Facility: INRA
Clone: SGN-C183531 [TUS-42-G17] Trace: SGN-T194935 EST: SGN-E399156 Direction: 3' Facility: INRA
Clone: SGN-C183531 [TUS-42-G17] Trace: SGN-T195488 EST: SGN-E394162 Direction: 3' Facility: INRA
Clone: SGN-C183531 [TUS-42-G17] Trace: SGN-T195952 EST: SGN-E394626 Direction: 5' Facility: INRA
Clone: SGN-C183531 [TUS-42-G17] Trace: SGN-T195952 EST: SGN-E399157 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398079Length: 382 bp (867 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398079 [] (trimmed) CTCCAGGGGAATTACCAAAATGGTATGCAATAGTGGTTGTGATATTCATTTGTGTATATGTTGCTGGATTCGCTTGGTCATGGGGTCCTCTTGGA
TGGCTCGTACCTAGTGAAATTTTCCCACTGGAAATTCGATCAGCTGCACAAAGTATCAATGTCTCAGTGAACATGATCTTCACATTTGCAGTAGC
ACAAGTTTTCTTAACAATGTTGTGTCATTTGAAGTTTGGATTGTTTCTGTTTTTCGCCTTCTTTGTGGTGATTATGACTGTGTTCATATACTTCT
TCTTGCCTGAGACGAAAAATATTCCGATAGAAGAGATGGTGATTGTGTGGAAAGAACATTGGTTCTGGTCTAAGTTCATGACTGAAGTTGATTAT
CC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398079] SGN-U584262 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199405 [Download][View] Facility Assigned ID: FA0AAD30AD09RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5