EST details — SGN-E398082

Search information 
Request: 398082Match: SGN-E398082
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183627Clone name: TUS-42-K17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183627 is on microarray TOM1 spot ID 1-1-8.3.1.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C32358 [cLEG-1-A15] Trace: SGN-T64359 EST: SGN-E248296 Direction: 5' Facility: TIGR
Clone: SGN-C183627 [TUS-42-K17] Trace: SGN-T195962 EST: SGN-E394636 Direction: 5' Facility: INRA
Clone: SGN-C183627 [TUS-42-K17] Trace: SGN-T195962 EST: SGN-E399179 Direction: 5' Facility: INRA
Clone: SGN-C183627 [TUS-42-K17] Trace: SGN-T199408 EST: SGN-E399178 Direction: 3' Facility: INRA
Clone: SGN-C183627 [TUS-42-K17] Trace: SGN-T199571 EST: SGN-E398245 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398082Length: 95 bp (981 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398082 [] (trimmed - flagged) GAAGATGCAGGGTTCTTTTAAGCCTTGGCCTGGTGATGAAGGTCCAAAGCGGTGGGAACAAGCATGGATGGCCATAAAAAAGGTGTTTCCTAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T199408 [Download][View] Facility Assigned ID: FA0AAD30AF09FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Problems: Possibly chimeric (anomalous insert into vector)
Sequence Entropy: 0.896 Expected Error Rate: 0.0158 Quality Trim Threshold: 14.5